Review




Structured Review

Biotechnology Information nucleic acid sequence alignment tool (blast)
Nucleic Acid Sequence Alignment Tool (Blast), supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleic+acid+sequence+alignment+tool+(blast)/nucleic+acid+sequence+alignment+tool++blast+/pmc12163035-84-30-28
Average 90 stars, based on 1 article reviews
nucleic acid sequence alignment tool (blast) - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

other:

Article Title: Bacteria of the genus Asaia contaminating non-alcoholic beverages produce biogenic amines, posing a health risk.
Article Snippet: 7 7 5 9 / c u r e u s . 6 8 5 7 7 National Center for Biotechnology Information (NCBI) (2025a) Core nucleotide BLAST database (contains GenBank + EMBL + DDBJ + PDB + RefSeq sequences).

Sequencing:

Article Title: Synergistic activity of ceftazidime/avibactam combined with aztreonam against MBL-producing exoY+/exoT+/exoU+/exoS- extensively drug-resistant Pseudomonas aeruginosa
Article Snippet: .. The sequencing results were compared with those available in the National Center for Biotechnology Information (NCBI) GenBank database ( https://blast.ncbi.nlm.nih.gov/ ). ..

Article Title: Molecular and Functional Characterization of Neuropeptide F Receptor in Pomacea canaliculata : Roles in Feeding and Digestion and Communication with the Insulin Pathway
Article Snippet: .. The amino acid (aa) sequence of PcNPFR (GenBank accession number, XP_025096430.1 ) were selected as the query to map the National Center for Biotechnology Information (NCBI) GenBank database via BlastP ( https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome accessed on 14 July 2025) and retrieve available NPFR orthologs from other species. ..

Article Title: Starter Culture‐Induced Fermentation Reveals Genotype‐Driven Variability in the Composition and Quality of Brazilian Amazon Forastero Cocoa Beans
Article Snippet: DNA was extracted with the ZR Fungal/Bacterial DNA MicroPrep Kit (D6007), amplified using primers 27‐F (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and 1512‐R (5′‐CGGCTACCTTGTTACGACT‐3′) in a Veriti Thermal Cycler (Applied Biosystems), and purified using Agencourt AMPure XP (Beckman Coulter, Pasadena, CA). .. Sequencing was performed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied, Cleveland, OH) on an ABI 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA), and the sequences were aligned in BioEdit 7.7 and identified by BLAST against GenBank (National Center for Biotechnology Information, Bethesda, MD). ..



Similar Products

90
Biotechnology Information nucleic acid sequence alignment tool (blast)
Nucleic Acid Sequence Alignment Tool (Blast), supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleic+acid+sequence+alignment+tool+(blast)/nucleic+acid+sequence+alignment+tool++blast+/pmc12163035-84-30-28
Average 90 stars, based on 1 article reviews
nucleic acid sequence alignment tool (blast) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results